Strategies for the Synthesis of Mono- and Bis-Thionaphthoquinones

The subclass of compounds which have the nucleus 1,4-naphthoquinone is the most various of the class of quinones, which have a big quantity of substances and a number of which have helpful purposes starting from medicinal chemistry to software in supplies with particular properties. The introduction of one or two substituents with the sulfur heteroatom in the naphthoquinone nucleus generates merchandise containing alkyl and aryl teams that amplify sure organic properties in opposition to micro organism, viruses and fungi. The inexperienced, purple, and brown algae have been proven to have helpful therapeutic properties in the prevention and therapy of neurodegenerative illnesses: Parkinson, Alzheimer’s, and Multiple Sclerosis, and different persistent illnesses.

There are a number of strategies of getting ready these compounds, primarily from low molecular weight naphthoquinones with two electrophilic websites succesful of reacting with sulfides producing variety and new lessons of compounds, together with new sulfur heterocycles and sulfur heterocycles fused with naphthoquinones. These compounds have been proven to be bioactive in opposition to a number of organic targets. This overview will describe the strategies of their synthesis and, when relevant, their organic actions.

Edible marine algae are wealthy in bioactive compounds and are, subsequently, a supply of bioavailable proteins, lengthy chain polysaccharides that behave as low-calorie soluble fibers, metabolically needed minerals, nutritional vitamins, polyunsaturated fatty acids, and antioxidants. Marine algae have been used primarily as gelling brokers and thickeners (phycocolloids) in meals and pharmaceutical industries in the final century, however latest analysis has revealed their potential as a supply of helpful compounds for the pharmaceutical, medical, and beauty industries.  In this overview are listed and described the essential parts of an appropriate eating regimen for sufferers with these illnesses. In addition, compounds derived from macroalgae and their neurophysiological actions are described.

Antiviral and immunomodulatory exercise of curcumin: A case for prophylactic remedy for COVID-19

Coronavirus disease-19 (COVID-19), a devastating respiratory sickness brought on by SARS-associated coronavirus-2 (SARS-CoV-2), has already affected over 64 million folks and triggered 1.48 million deaths, simply 12 months from the first prognosis. COVID-19 sufferers develop critical issues, together with extreme pneumonia, acute respiratory misery syndrome (ARDS), and or multiorgan failure on account of exaggerated host immune response following an infection. Currently, medication that have been efficient in opposition to SARS-CoV are being repurposed for SARS-CoV-2. During this public well being emergency, meals nutraceuticals may very well be promising prophylactic therapeutics for COVID-19.

Curcumin, a bioactive compound in turmeric, exerts various pharmacological actions and is extensively utilized in meals and conventional medicines. This overview presents a number of strains of proof, which counsel curcumin as a promising prophylactic, therapeutic candidate for COVID-19. First, curcumin exerts antiviral exercise in opposition to many sorts of enveloped viruses, together with SARS-CoV-2, by a number of mechanisms: direct interplay with viral membrane proteins; disruption of the viral envelope; inhibition of viral proteases; induce host antiviral responses. Second, curcumin protects from deadly pneumonia and ARDS by way of focusing on NF-κB, inflammasome, IL-6 trans sign, and HMGB1 pathways.

Breast most cancers is the most frequent feminine most cancers and one of the main causes of most cancers demise in girls. There are many chemotherapy brokers accessible for the therapy of breast most cancers, however the present therapeutic choices haven’t fulfilled the desired outcomes particularly for the drug-resistant breast most cancers remedy. Thus, there may be an pressing must develop novel anti-breast most cancers brokers. Coumarin is ubiquitous in pure and artificial bioactive compounds, and coumarin derivatives are readily interacting with a range of enzymes and receptors in breast most cancers cells.

Moreover, the coumarin-based Irosustat as the first-generation steroid sulfatase inhibitor in breast most cancers is below scientific evaluations, revealing the potential of coumarin derivatives as novel anti-breast most cancers brokers. This overview goals to explain the latest growth of pure and artificial coumarin derivatives with anti-breast most cancers potential, protecting the articles printed from 2015 to 2020. Third, curcumin is protected and well-tolerated in each wholesome and diseased human topics. In conclusion, collected proof signifies that curcumin could also be a possible prophylactic therapeutic for COVID-19 in the clinic and public well being settings.

 Strategies for the Synthesis of Mono- and Bis-Thionaphthoquinones

Phytochemical screening, in vitro antioxidant and enzyme inhibitory proprieties and acute toxicity of extracts from the aerial elements of Ephedra nebrodensis, supply of bioactive compounds

 The goal of this examine was to judge the in vitro antioxidant and the enzyme inhibitory properties and to establish the bioactive compounds current in the extracts of Ephedra nebrodensis rising in Algeria. Total phenolic and flavonoids content material in these extracts have been quantified by Folin-Ciocalteu and aluminum chloride strategies. The antioxidant capability was assessed utilizing DPPH, ABTS, β-carotene/linoleic acid, CUPRAC and FRAP assays and in vitro cholinesterase exercise in opposition to acetylcholinesterase and butyrylcholinesterase have been evaluated. The chemical constituents of the extracts have been analyzed by high-performance liquid chromatography coupled to mass spectrometric detection and gasoline chromatography coupled to mass spectrometric detection. For the acute toxicity examine, extracts have been administered to mice at single dose of 2 g/kg and 5 g/kg by gavage.

Human LILRB4/ CD85k/ ILT3 Bioactive Protein, His, Yeast-20ug

QP2848-20ug 20ug
EUR 245

Recombinant human LILRB4/CD85k/ILT3 Protein

RP01155 10 μg
EUR 230

Recombinant human LILRB4/CD85k/ILT3 Protein

RP01185 10 μg
EUR 193

Human CellExp? LILRB4 / CD85k / ILT3, Cynomolgus Recombinant

EUR 164

Human CellExp? LILRB4 / CD85k / ILT3, Cynomolgus Recombinant

EUR 544

Human CellExp? LILRB4 / CD85k / ILT3, Mouse Recombinant

EUR 164

Human CellExp? LILRB4 / CD85k / ILT3, Mouse Recombinant

EUR 588

Human CellExp? LILRB4 / CD85k / ILT3, Mouse Recombinant

EUR 185

Human CellExp? LILRB4 / CD85k / ILT3, Mouse Recombinant

EUR 729

Recombinant Mouse LILRB4/CD85k/ILT3 (C-6His)

CS97-10ug 10ug
EUR 156
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Mouse LILRB4/CD85k/ILT3 (C-6His)

CS97-1mg 1mg
EUR 1877
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Mouse LILRB4/CD85k/ILT3 (C-6His)

CS97-500ug 500ug
EUR 1328
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Mouse LILRB4/CD85k/ILT3 (C-6His)

CS97-50ug 50ug
EUR 369
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Human Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 4 (LILRB4) ELISA Kit

EUR 498
  • Should the Human Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 4 (LILRB4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 4 (LILRB4) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 4 (LILRB4) ELISA Kit

EUR 647
  • Should the Human Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 4 (LILRB4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 4 (LILRB4) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 4 (LILRB4) ELISA Kit

RDR-LILRB4-Hu-48Tests 48 Tests
EUR 522

Human Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 4 (LILRB4) ELISA Kit

RDR-LILRB4-Hu-96Tests 96 Tests
EUR 724

Human Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 4 (LILRB4) ELISA Kit

RD-LILRB4-Hu-48Tests 48 Tests
EUR 500

Human Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 4 (LILRB4) ELISA Kit

RD-LILRB4-Hu-96Tests 96 Tests
EUR 692

LILRB4 Recombinant Protein (Human)

RP017800 100 ug Ask for price

Human Angiotensin I, pure (bioactive)

AT55-P-5 5 mg
EUR 529

Human Angiotensin II, pure (bioactive)

AT65-P-5 5 mg
EUR 286

Human Angiotensin III, pure (bioactive)

AT75-P-5 5 mg
EUR 286

DiscoveryProbe? Bioactive Compound Library

L1022-.1 100 uL/well(10 mM solution)
EUR 23389

DiscoveryProbe? Bioactive Compound Library

L1022-.25 250 uL/well(10 mM solution)
EUR 42042

DiscoveryProbe? Bioactive Compound Library

L1022-5 5 mg/well
EUR 54686

Cyclophilin-F Rat Recombinant Protein Bioactive

PROTP29117-1 Regular: 10ug
EUR 317
Description: Cyclophilin F Rat Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 200 amino acids (30-206 a.a) and having a molecular mass of 21.2Da. Cyclophilin F is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

LILRB4 Antibody

34759-100ul 100ul
EUR 252

LILRB4 Antibody

34759-50ul 50ul
EUR 187

LILRB4 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against LILRB4. Recognizes LILRB4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

LILRB4 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against LILRB4. Recognizes LILRB4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

LILRB4 Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against LILRB4. Recognizes LILRB4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF;IF:1:100-1:500

LILRB4 Antibody

CSB-PA297929-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against LILRB4. Recognizes LILRB4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF;IF:1:100-1:500

LILRB4 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against LILRB4. Recognizes LILRB4 from Human. This antibody is Unconjugated. Tested in the following application: IF, ELISA;IF:1/200-1/1000.ELISA:1/20000

LILRB4 antibody

70R-35844 100 ug
EUR 327
Description: Rabbit polyclonal LILRB4 antibody


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA25711 50 ul
EUR 334
Description: Mouse polyclonal to LILRB4

LILRB4 Recombinant Protein (Rat)

RP208181 100 ug Ask for price

LILRB4 Recombinant Protein (Mouse)

RP147467 100 ug Ask for price


ELA-E5609h 96 Tests
EUR 824


EF006382 96 Tests
EUR 689


ELI-45775h 96 Tests
EUR 824

Human LILRB4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human Angiotensin II (1-4), pure (bioactive)

AT66-P-5 5 mg
EUR 286

Human Angiotensin II (3-8), pure (bioactive)

AT67-P-5 5 mg
EUR 286

Human Angiotensin II (4-8), pure (bioactive)

AT68-P-5 5 mg
EUR 286

Human Angiotensin II (5-8), pure (bioactive)

AT69-P-5 5 mg
EUR 286

DCXR Human, Dicarbonyl/L-Xylulose Reductase Human Recombinant Protein, Bioactive

PROTQ7Z4W1-1 Regular: 10ug
EUR 317
Description: DCXR Recombinant Human produced in E.Coli is a single, non-glycosylated polypeptide chain containing 264 amino acids (1-244 a.a.) and having a molecular mass of 28 kDa. The DCXR is fused to a 20 amino acids His-Tag at N-terminus and purified by proprietary chromatographic techniques.

LILRB4 Conjugated Antibody

C34759 100ul
EUR 397

LILRB4 cloning plasmid

CSB-CL850914HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1347
  • Sequence: atgatccccaccttcacggctctgctctgcctcgggctgagtctgggccccaggaccgacatgcaggcagggcccctccccaaacccaccctctgggctgagccaggctctgtgatcagctgggggaactctgtgaccatctggtgtcaggggaccctggaggctcgggagtacc
  • Show more
Description: A cloning plasmid for the LILRB4 gene.

LILRB4 Rabbit pAb

A7073-100ul 100 ul
EUR 308

LILRB4 Rabbit pAb

A7073-200ul 200 ul
EUR 459

LILRB4 Rabbit pAb

A7073-20ul 20 ul
EUR 183

LILRB4 Rabbit pAb

A7073-50ul 50 ul
EUR 223

pBluescriptR-LILRB4 Plasmid

PVT16920 2 ug
EUR 325

Anti-LILRB4 antibody

STJ29153 100 µl
EUR 277
Description: This gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family, which is found in a gene cluster at chromosomal region 19q13.4. The encoded protein belongs to the subfamily B class of LIR receptors which contain two or four extracellular immunoglobulin domains, a transmembrane domain, and two to four cytoplasmic immunoreceptor tyrosine-based inhibitory motifs (ITIMs). The receptor is expressed on immune cells where it binds to MHC class I molecules on antigen-presenting cells and transduces a negative signal that inhibits stimulation of an immune response. The receptor can also function in antigen capture and presentation. It is thought to control inflammatory responses and cytotoxicity to help focus the immune response and limit autoreactivity. Multiple transcript variants encoding different isoforms have been found for this gene.

Rat/Canine Angiotensin I, pure (bioactive)

AT56-P-1 1 mg
EUR 286

Human CellExp? LILRB4, Cynomolgus Recombinant

EUR 185

Human CellExp? LILRB4, Cynomolgus Recombinant

EUR 729

LILRB4 ORF Vector (Human) (pORF)

ORF005934 1.0 ug DNA
EUR 95

LILRB4 ELISA Kit (Human) (OKCD07380)

OKCD07380 96 Wells
EUR 936
Description: Description of target: Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab);Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.057ng/mL

LILRB4 ELISA Kit (Human) (OKEH01767)

OKEH01767 96 Wells
EUR 662
Description: Description of target: This gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family, which is found in a gene cluster at chromosomal region 19q13.4. The encoded protein belongs to the subfamily B class of LIR receptors which contain two or four extracellular immunoglobulin domains, a transmembrane domain, and two to four cytoplasmic immunoreceptor tyrosine-based inhibitory motifs (ITIMs). The receptor is expressed on immune cells where it binds to MHC class I molecules on antigen-presenting cells and transduces a negative signal that inhibits stimulation of an immune response. The receptor can also function in antigen capture and presentation. It is thought to control inflammatory responses and cytotoxicity to help focus the immune response and limit autoreactivity. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.082 ng/mL

LILRB4 Protein Vector (Human) (pPB-C-His)

PV023733 500 ng
EUR 329

LILRB4 Protein Vector (Human) (pPB-N-His)

PV023734 500 ng
EUR 329

LILRB4 Protein Vector (Human) (pPM-C-HA)

PV023735 500 ng
EUR 329

LILRB4 Protein Vector (Human) (pPM-C-His)

PV023736 500 ng
EUR 329

LILRB4 Recombinant Protein (Human) (C-Fc Tag)

RP238855 1mg Ask for price

LILRB4 Recombinant Protein (Human) (C-Fc Tag)

RP238856 50ug Ask for price

Human Hepcidine-25 bioactive(Hepc-25) ELISA Kit

QY-E05472 96T
EUR 361

ENTPD3 Human, Ectonucleoside Triphosphate Diphosphohydrolase 3 Human Recombinant Protein, sf9 Bioactive

PROTO75355-2 Regular: 4ug
EUR 317
Description: ENTPD3 Human Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 451 amino acids (44-485a.a.) and having a molecular mass of 50.7kDa (Molecular size on SDS-PAGE will appear at approximately 50-70kDa).;ENTPD3 is expressed with a 6 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques.

Anti-LILRB4/Gp49 Antibody

A04924 100ul
EUR 397
Description: Rabbit Polyclonal LILRB4/Gp49 Antibody. Validated in IF and tested in Human.

Mouse Lilrb4 ELISA KIT

ELI-42013m 96 Tests
EUR 865

Mouse LILRB4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human LILRB4 Protein (Gln 22-Glu 259) [His]

VAng-1892Lsx-100g 100 µg
EUR 1013
Description: Human LILRB4 protein, His tag, expressed in human 293 cells. (Uniprot ID: AAH26309.1)

Human LILRB4 Protein (Gln 22-Glu 259) [His]

VAng-1892Lsx-1mg 1 mg
EUR 6402
Description: Human LILRB4 protein, His tag, expressed in human 293 cells. (Uniprot ID: AAH26309.1)

LILRB4 sgRNA CRISPR Lentivector set (Human)

K1215601 3 x 1.0 ug
EUR 339

IMPAD1 Inositol Monophosphatase Domain Containing 1 Mouse Recombinant Protein Bioactive

PROTQ80V26-1 Regular: 10ug
EUR 317
Description: IMPAD1 Mouse Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 332 amino acids (34-356a.a.) and having a molecular mass of 36.2kDa. (Molecular size on SDS-PAGE will appear at approximately 28-40kDa). IMPAD1 is expressed with a 6 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques.

LILRB4 Protein Vector (Rat) (pPB-C-His)

PV277578 500 ng
EUR 603

LILRB4 Protein Vector (Rat) (pPB-N-His)

PV277579 500 ng
EUR 603

LILRB4 Protein Vector (Rat) (pPM-C-HA)

PV277580 500 ng
EUR 603

LILRB4 Protein Vector (Rat) (pPM-C-His)

PV277581 500 ng
EUR 603

LILRB4 Protein Vector (Mouse) (pPB-C-His)

PV196626 500 ng
EUR 603

LILRB4 Protein Vector (Mouse) (pPB-N-His)

PV196627 500 ng
EUR 603

LILRB4 Protein Vector (Mouse) (pPM-C-HA)

PV196628 500 ng
EUR 603

LILRB4 Protein Vector (Mouse) (pPM-C-His)

PV196629 500 ng
EUR 603

Lilrb4 ORF Vector (Rat) (pORF)

ORF069395 1.0 ug DNA
EUR 506

Lilrb4 ORF Vector (Mouse) (pORF)

ORF049157 1.0 ug DNA
EUR 95

LILRB4 ELISA Kit (Mouse) (OKEH05081)

OKEH05081 96 Wells
EUR 662
Description: Description of target: Receptor for class I MHC antigens. Involved in the down-regulation of the immune response and the development of tolerance. Interferes with TNFRSF5-signaling and NF-kappa-B up-regulation. Inhibits receptor-mediated phosphorylation of cellular proteins and mobilization of intracellular calcium ions.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.177 ng/mL

LILRB4 sgRNA CRISPR Lentivector (Human) (Target 1)

K1215602 1.0 ug DNA
EUR 154

LILRB4 sgRNA CRISPR Lentivector (Human) (Target 2)

K1215603 1.0 ug DNA
EUR 154

LILRB4 sgRNA CRISPR Lentivector (Human) (Target 3)

K1215604 1.0 ug DNA
EUR 154

Human LILRB4 Protein (Gln 22-Glu 259) [human IgG1 Fc tag]

VAng-1893Lsx-1mg 1 mg
EUR 6099
Description: Human LILRB4 protein, human IgG1 Fc tag, expressed in human 293 cells. (Uniprot ID: AAH26309)

Human LILRB4 Protein (Gln 22-Glu 259) [human IgG1 Fc tag]

VAng-1893Lsx-50g 50 µg
EUR 1013
Description: Human LILRB4 protein, human IgG1 Fc tag, expressed in human 293 cells. (Uniprot ID: AAH26309)

Cynomolgus LILRB4 Protein (Gln 22-Glu 259) [His]

VAng-1662Lsx-100g 100 µg
EUR 1288
Description: Cynomolgus LILRB4 protein, His tag, expressed in human 293 cells. (Uniprot ID: XP_015297198.1)

Cynomolgus LILRB4 Protein (Gln 22-Glu 259) [His]

VAng-1662Lsx-1mg 1 mg
EUR 7749
Description: Cynomolgus LILRB4 protein, His tag, expressed in human 293 cells. (Uniprot ID: XP_015297198.1)

Mouse LILRB4 Protein (Gly 24-Lys 238) [Fc]

VAng-1947Lsx-100g 100 µg
EUR 1288
Description: Mouse LILRB4 protein, Fc tag, expressed in human 293 cells. (Uniprot ID: Q64281-1)

Mouse LILRB4 Protein (Gly 24-Lys 238) [Fc]

VAng-1947Lsx-1mg 1 mg
EUR 6924
Description: Mouse LILRB4 protein, Fc tag, expressed in human 293 cells. (Uniprot ID: Q64281-1)

Mouse LILRB4 Protein (Gly 24-Lys 238) [His]

VAng-1948Lsx-100g 100 µg
EUR 1288
Description: Mouse LILRB4 protein, His tag, expressed in human 293 cells. (Uniprot ID: Q64281-1)

Mouse LILRB4 Protein (Gly 24-Lys 238) [His]

VAng-1948Lsx-1mg 1 mg
EUR 6649
Description: Mouse LILRB4 protein, His tag, expressed in human 293 cells. (Uniprot ID: Q64281-1)

Lilrb4 sgRNA CRISPR Lentivector set (Rat)

K6091001 3 x 1.0 ug
EUR 339

Lilrb4 sgRNA CRISPR Lentivector set (Mouse)

K3942001 3 x 1.0 ug
EUR 339

Human Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 4 (LILRB4) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Cynomolgus LILRB4 Protein (Gln 22-Glu 259) [human IgG1 Fc tag]

VAng-1663Lsx-100g 100 µg
EUR 1288
Description: Cynomolgus LILRB4 protein, human IgG1 Fc tag, expressed in human 293 cells. (Uniprot ID: XP_015297198.1)

Cynomolgus LILRB4 Protein (Gln 22-Glu 259) [human IgG1 Fc tag]

VAng-1663Lsx-1mg 1 mg
EUR 6924
Description: Cynomolgus LILRB4 protein, human IgG1 Fc tag, expressed in human 293 cells. (Uniprot ID: XP_015297198.1)

Human LILRB4 Protein (Gln 22-Glu 259) [mouse IgG2a Fc tag]

VAng-1894Lsx-100g 100 µg
EUR 1013
Description: Human LILRB4 protein, mouse IgG2a Fc tag, expressed in human 293 cells. (Uniprot ID: AAH26309.1)

Human LILRB4 Protein (Gln 22-Glu 259) [mouse IgG2a Fc tag]

VAng-1894Lsx-1mg 1 mg
EUR 6402
Description: Human LILRB4 protein, mouse IgG2a Fc tag, expressed in human 293 cells. (Uniprot ID: AAH26309.1)

Human Leukocyte Immunoglobulin Like Receptor B4 (LILRB4) ELISA Kit

abx571133-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Lilrb4 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6091002 1.0 ug DNA
EUR 154

Lilrb4 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6091003 1.0 ug DNA
EUR 154

Lilrb4 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6091004 1.0 ug DNA
EUR 154

Lilrb4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3942002 1.0 ug DNA
EUR 154

Lilrb4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3942003 1.0 ug DNA
EUR 154

Lilrb4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3942004 1.0 ug DNA
EUR 154

Lilrb4 3'UTR Luciferase Stable Cell Line

TU111058 1.0 ml Ask for price

Lilrb4 3'UTR GFP Stable Cell Line

TU161058 1.0 ml Ask for price

Lilrb4 3'UTR Luciferase Stable Cell Line

TU207076 1.0 ml Ask for price

Lilrb4 3'UTR GFP Stable Cell Line

TU257076 1.0 ml Ask for price

LILRB4 3'UTR GFP Stable Cell Line

TU062464 1.0 ml
EUR 1521

LILRB4 3'UTR Luciferase Stable Cell Line

TU012464 1.0 ml
EUR 1521

LILRB4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1215605 3 x 1.0 ug
EUR 376

LILRB4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV650449 1.0 ug DNA
EUR 682

LILRB4 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV650453 1.0 ug DNA
EUR 682

LILRB4 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV650454 1.0 ug DNA
EUR 682

Mouse Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 4 (LILRB4) Protein

  • EUR 746.00
  • EUR 300.00
  • EUR 2346.00
  • EUR 899.00
  • EUR 537.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Cynomolgus LILRB4 Protein (Gln 22-Glu 259) [mouse IgG2a Fc tag]

VAng-1664Lsx-100g 100 µg
EUR 1178
Description: Cynomolgus LILRB4 protein, mouse IgG2a Fc tag, expressed in human 293 cells. (Uniprot ID: XP_015297198.1)

Cynomolgus LILRB4 Protein (Gln 22-Glu 259) [mouse IgG2a Fc tag]

VAng-1664Lsx-1mg 1 mg
EUR 6924
Description: Cynomolgus LILRB4 protein, mouse IgG2a Fc tag, expressed in human 293 cells. (Uniprot ID: XP_015297198.1)

LILRB4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1215606 1.0 ug DNA
EUR 167

LILRB4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1215607 1.0 ug DNA
EUR 167

LILRB4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1215608 1.0 ug DNA
EUR 167

Recombinant (E. coli) Human Epidermal Growth (EGF, Urogastrone, URG) (>98%, No-tag, bioactive, low endotoxin)

EGF15-R-100 100 ug
EUR 286

Recombinant (HEK) Human Epidermal growth factor (EGF, Urogastrone, URG) (>98%, No-tag, bioactive, low endotoxin)

EGF16-R-100 100 ug
EUR 529

Recombinant (CHO) Human Angiopoietin 2 (Ang-2) protein (484-aa, ~56 kda, His-tag, >95%, Low endotoxin), bioactive

ANG27-R-10 10 ug
EUR 408

Mouse Leukocyte Immunoglobulin Like Receptor B4 (LILRB4) ELISA Kit

abx520500-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

human leukocyte immunoglobulin-like receptor subfamily B member 4,LILRB4 ELISA Kit

201-12-0241 96 tests
EUR 440
  • This leukocyte immunoglobulin-like receptor subfamily B member 4 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Leukocyte Immunoglobulin Like Receptor Subfamily B Member 4 (LILRB4) CLIA Kit

abx197216-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Leukocyte Immunoglobulin Like Receptor Subfamily B Member 4 (LILRB4) ELISA Kit

abx054931-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human Leukocyte Immunoglobulin Like Receptor Subfamily B Member 4 (LILRB4) ELISA Kit

  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Leukocyte Immunoglobulin Like Receptor Subfamily B Member 4 (LILRB4) ELISA Kit

abx251677-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human LILRB4(Leukocyte immunoglobulin-like receptor subfamily B member 4) ELISA Kit

EH2323 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q8NHJ6
  • Alias: LILRB4/CD85k/HM18/ILT3/LIR5/CD85 antigen-like family member K/CD85k/CD85k antigen/ILT-3/ILT3CD85K/leukocyte immunoglobulin-like receptor, subfamily B(with TM and ITIM domains)/LIR5LILRB5/LIR-5
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human LILRB4/ Leukocyte immunoglobulin-like receptor subfamily B member 4 ELISA Kit

E1469Hu 1 Kit
EUR 571

Human leukocyte immunoglobulin-like receptor subfamily B member 4, LILRB4 ELISA Kit

CSB-E11812h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human leukocyte immunoglobulin-like receptor subfamily B member 4, LILRB4 in samples from serum, plasma, cell culture supernates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human leukocyte immunoglobulin-like receptor subfamily B member 4, LILRB4 ELISA Kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human leukocyte immunoglobulin-like receptor subfamily B member 4, LILRB4 in samples from serum, plasma, cell culture supernates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Leukocyte Immunoglobulin Like Receptor Subfamily B Member 4 (LILRB4) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human leukocyte immunoglobulin-like receptor subfamily B member 4(LILRB4)ELISA Kit

GA-E0257HM-48T 48T
EUR 289

Human leukocyte immunoglobulin-like receptor subfamily B member 4(LILRB4)ELISA Kit

GA-E0257HM-96T 96T
EUR 466

Human leukocyte immunoglobulin-like receptor subfamily B member 4(LILRB4)ELISA Kit

QY-E04237 96T
EUR 361

Human Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 4 (LILRB4) ELISA Kit

SEB399Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 4 (LILRB4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 4 (LILRB4) in tissue homogenates, cell lysates and other biological fluids.

Human Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 4 (LILRB4) ELISA Kit

SEB399Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 4 (LILRB4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 4 (LILRB4) in tissue homogenates, cell lysates and other biological fluids.

Human Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 4 (LILRB4) ELISA Kit

SEB399Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 4 (LILRB4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 4 (LILRB4) in tissue homogenates, cell lysates and other biological fluids.

Human Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 4 (LILRB4) ELISA Kit

SEB399Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 4 (LILRB4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 4 (LILRB4) in tissue homogenates, cell lysates and other biological fluids.

Human Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 4 (LILRB4) ELISA Kit

  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 4 elisa. Alternative names of the recognized antigen: CD85k
  • LILR-B4
  • LILRB5
  • HM18
  • ILT3
  • LIR-5
  • Immunoglobulin-like transcript 3
  • Leukocyte immunoglobulin-like receptor 5
  • CD85
  • Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 4 (LILRB4) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Leukocyte Immunoglobulin Like Receptor Subfamily B Member 4 (LILRB4) Antibody

abx026707-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Leukocyte Immunoglobulin Like Receptor Subfamily B Member 4 (LILRB4) Antibody

abx026707-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Leukocyte Immunoglobulin Like Receptor Subfamily B Member 4 (LILRB4) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 4 (LILRB4) Antibody

  • EUR 1149.00
  • EUR 565.00
  • 1 mg
  • 200 ug
  • Please enquire.
Plant extracts have been wealthy in phenolic compounds. Ethyl acetate extract introduced the highest phenolic (238.44 ± 1.50 µg GAE /mg of extract) and flavonoid (21.12 ± 0.00 µg QE /mg of extract) contents. Likewise, ethyl acetate extract confirmed potent radical scavenging and decreasing properties. Ethanol: acetone extract confirmed inhibitory exercise in opposition to acetylcholinesterase, and was a potent inhibitor of butyrylcholinesterase. In all extracts, flavonoids have been the most ample compounds. The phytochemical investigation confirmed the presence of alkaloids (ephedrine and pseudo-ephedrine). In the acute toxicity, the LD50 was superior to five g/kg physique weight. There are usually not alterations in the histology of the liver and kidneys.